Tổng hợp tài liệu :

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 6 doc

xây dựng quy trình phát hiện virus PMWaV-1

xây dựng quy trình phát hiện virus PMWaV-1
xây dựng quy trình phát hiện virus PMWaV-1 . thực hiện đề tài " ;Xây dựng qui trình phát hiện virus PMWaV-1 gây bệnh đỏ đầu trên chồi dứa Cayenne bằng phương pháp RT-PCR" nhằm xây dựng. CÔNG NGHỆ SINH HỌC ***000*** KHÓA LUẬN TỐT NGHIỆP XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA
  • 66
  • 1,372
  • 8

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR

Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR
Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR . TP. Hồ Chí Minh. Tháng 8/2006. Nghiên cứu một số virus (TMV, CMV) gây bệnh trên cây Ớt tại huyện Củ Chi, TP. Hồ Chí Minh bằng kỹ thuật ELISA và. (TMV, CMV) gây bệnh trên cây ớt tại huyện Củ Chi, Tp. Hồ Chí Minh bằng kỹ thuật ELISA và xây dựng quy trình phát hiện CMV bằng kỹ thuật RT-PCR đƣợc
  • 69
  • 872
  • 2

XÂY DỰNG QUY TRÌNH PHÁT HIỆN ĐỘT BIẾN rtA181V/T VÀ rtN236T KHÁNG ADEFOVIR CỦA VIRUS VIÊM GAN B (Hepatitis B Virus) BẰNG KỸ THUẬT REAL-TIME PCR

XÂY DỰNG QUY TRÌNH PHÁT HIỆN ĐỘT BIẾN rtA181V/T VÀ rtN236T KHÁNG ADEFOVIR CỦA VIRUS VIÊM GAN B (Hepatitis B Virus) BẰNG KỸ THUẬT REAL-TIME PCR
Viêm gan (VG) còn gọi sưng gan, một tình trạng bệnh lý phổ biến do thương tổn ở tế bào gan. Có nhiều nguyên nhân gây ra VG như: vi khuẩn, rượu, hóa chất và một vài loại thuốc cũng như vô số loại virus, trong đóvirus viêm gan B (VRVGB) [20]. VRVGB hay Hepatitis B virus (HBV) một trong những virus tiêu biểu của họ Hepadnaviridae, một họ gây VG cho nhiều loài động vật. HBV lây truyền qua đường máu, đường tình dục, từ mẹ sang con, qua tiếp xúc,… Quá trình nhiễm bệnh của HBV kéo dài, diễn tiến nặng, tỷ lệ tử vong cao. . tài Xây dựng quy trình phát hiện đột biến rtA181V/T và rtN236T kháng Adefovir của virus viêm gan B (Hepatitis B Virus) b ng kỹ thuật real- time PCR ,. tài: Xây dựng quy trình xác định các đột biến kháng thuốc Adefovir của HBV tại rtA181V/T và rtN236T b ng kỹ thuật real-time PCR sử dụng TaqMan probe, chi
  • 99
  • 926
  • 3

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng

Xây dựng Quy trình phát hiện Escherichia Coli trong thực phẩm bằng phương pháp PCR(Polumerase Chain Reaction) và thử nghiệm ứng dụng
Vấn đề vệ sinh thực phẩm luôn được đặt lên hàng đầu trong những chương trình phát triển của các quốc gia. Trong những năm gần đây, tình hình ngộ độc thực phẩm có xu hướng gia tăng cả về số lượng lân qui mô tác hại ở nhiều nước... . thực phẩm. Do vậy, mục tiêu của đề tài luận văn này thiết lập qui trình phát hiện E. coli trong thực phẩm bằng phương pháp PCR (Polymerase Chain Reaction). PHƯƠNG PHÁP PHÁT HIỆN E. COLI TRONG THỰC PHẨM 3.1. Phương pháp nuôi cấy truyền thống [6,10] Phương pháp nuôi cấy truyền thống để phát hiện E. coli gồm
  • 67
  • 1,209
  • 6

Luận văn Xây dựng quy trình cấp nhãn sinh thái cho sản phẩm ngành cao su Việt Nam

Luận văn Xây dựng quy trình cấp nhãn sinh thái cho sản phẩm ngành cao su Việt Nam
Luận văn Xây dựng quy trình cấp nhãn sinh thái cho sản phẩm ngành cao su Việt Nam Vấn đề nhãn môi trường đã được thảo luận tại cuộc họp tổ chức thương mại thế giới (WTO) tại... . VŨ ĐỨC TIẾN XÂY DỰNG QUY TRÌNH CẤP NHÃN SINH THÁI CHO SẢN PHẨM NGÀNH CAO SU VIỆT NAM LUẬN VĂN THẠC SĨ Chuyên ngành : Công nghệ môi. VŨ ĐỨC TIẾN XÂY DỰNG QUY TRÌNH CẤP NHÃN SINH THÁI CHO SẢN PHẨM NGÀNH CAO SU VIỆT NAM LUẬN VĂN THẠC SĨ Chuyên ngành : Công nghệ môi
  • 236
  • 696
  • 2

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
. 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 371 bp DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524. sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker oAvian Diseases, 40: 425-437.
  • 11
  • 473
  • 0

Tài liệu Luận văn Xây dựng hệ thống phát hiện xâm nhập bằng phần mềm Snort pot

Tài liệu Luận văn Xây dựng hệ thống phát hiện xâm nhập bằng phần mềm Snort pot
. này• Xây dựng hệ thống phát hiện bất thường bằng cách sử dụng phần mềm phát hiện xâm nhập Snort 3. Cấu trúc đề tài Chương 1: Giới thiệu tổng quan về Hệ thống. 3: Xây dựng hệ thống phát hiện xâm nhập với Snort cho một hệ thống thông tin. Đưa ra cách xây dụng một tập luật và ứng dụng nó để phát hiện các xâm nhập
  • 71
  • 888
  • 3

NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP. HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN CMV BẰNG KỸ THUẬT RT-PCR pot

NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP. HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN CMV BẰNG KỸ THUẬT RT-PCR pot
. NGHIÊN CỨU VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP. HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN CMV BẰNG KỸ THUẬT. VIRUS (TMV, CMV) GÂY BỆNH TRÊN CÂY ỚT TẠI HUYỆN CỦ CHI, TP. HỒ CHÍ MINH BẰNG KỸ THUẬT ELISA VÀ XÂY DỰNG QUY TRÌNH PHÁT HIỆN CMV BẰNG KỸ THUẬT RT-PCR
  • 69
  • 639
  • 0

Luận văn: Xây dựng quy trình sản xuất sinh khối sợi nấm doc

Luận văn: Xây dựng quy trình sản xuất sinh khối sợi nấm doc
. tôi quy t định thực hiện đề tài Xây dựng quy trình sản xuất sinh khối sợi nấm Ganoderma lucidum”. 1.2 MỤC ĐÍCH Xây dựng quy trình sản xuất sinh khối. VÀ ĐÀO TẠO TRƯỜNG…………………….  Luận văn Xây dựng quy trình sản xuất sinh khối sợi nấm SVTH: Nguyễn Vũ Duy Khanh GVHD: Th.S
  • 47
  • 617
  • 0

ỨNG DỤNG KỸ THUẬT RT-PCR PHÁT HIỆN VIRUS PMWaV-1 (Pineapple mealybug wilt associated virus-1) GÂY BỆNH HÉO ĐỎ ĐẦU TRÊN CÂY DỨA CAYENNE ppt

ỨNG DỤNG KỸ THUẬT RT-PCR PHÁT HIỆN VIRUS PMWaV-1 (Pineapple mealybug wilt associated virus-1) GÂY BỆNH HÉO ĐỎ ĐẦU LÁ TRÊN CÂY DỨA CAYENNE ppt
. LAN THANH ỨNG DỤNG KỸ THUẬT RT-PCR PHÁT HIỆN VIRUS PMWaV-1 (Pineapple mealybug wilt associated virus- 1) GÂY BỆNH HÉO ĐỎ ĐẦU TRÊN CÂY DỨA CAYENNE LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH.  ỨNG DỤNG KỸ THUẬT RT-PCR PHÁT HIỆN VIRUS PMWaV-1 (Pineapple mealybug wilt associated virus- 1) GÂY BỆNH HÉO ĐỎ ĐẦU TRÊN CÂY DỨA CAYENNE LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH. khu vực trồng dứa. Với đề tài Ứng dụng kỹ thuật RT-PCR phát hiện virus PMWaV-1 gây bệnh héo đỏ đầu trên cây dứa Cayenne , chúng tôi hy vọng góp phần cung cấp cây giống sạch bệnh và có khả
  • 59
  • 452
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 3 docx
. dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân tử. (1) (2) (3a) xiii Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. Kết luận - Đã phân lập đƣợc 4 dòng vi khuẩn gây. 16s-23s rDNA ITS. Dựa trên kết quả phân tích và thực hiện các thí nghiệm có thể đƣa ra những bƣớc cơ bản để định danh dòng vi khuẩn gây bệnh loét trên cây có múi dựa trên kỹ thuật sinh học phân. XBDL3 XBĐ C3 PHẦN 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở cây bƣởi da láng và bƣởi đƣờng cam Chúng tôi đã tiến hành phân lập đƣợc 4 dòng vi khuẩn trên
  • 17
  • 515
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 2 pptx
. ở nhiệt độ 27 o C-30 o C, trong vòng 7 ngày sau khi chủng thì thấy triệu chứng bệnh. 2. 6 .2 Quy trình định danh theo phƣơng pháp phân tử Dựa trên quy trình định danh bằng phƣơng pháp nuôi cấy. Tác giả đã phân lập đƣợc một số dòng vi khuẩn gây bệnh nhƣng chƣa định danh đƣợc. Đồng thời, tác giả cũng xác định một số loại thuốc hóa học phòng trừ bệnh loét. 2. 6. Quy trình định danh Xanthomona. dòng vi khuẩn gây bệnh gram âm hay gram dƣơng, quan sát hình thái trên môi trƣờng PGA, YDC. 2. Chủng bệnh nhân tạo xác định dòng vi khuẩn phân lập đƣợc dòng vi khuẩn có khả năng gây bệnh
  • 17
  • 456
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 1 doc

Luận văn : XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƯỞI BẰNG PHƯƠNG PHÁP SINH HỌC PHÂN TỬ part 1 doc
. “XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ”. Giáo vi n hƣớng dẫn: TS. LÊ ĐÌNH ĐÔN Đề tài đƣợc thực hiện trên đối tƣợng vi khuẩn. BỘ MÔN CÔNG NGHỆ SINH HỌC  XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN. sp. . 12 2.6 .1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp nuôi cấy, thực hiện phản ứng sinh hóa 12 2.6.2 Quy trình định danh theo phƣơng pháp phân tử 13 2.7 Phƣơng pháp PCR 13 Phần
  • 17
  • 477
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc
. ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC : || :: : 3' CACTCACAACAGGAAGGACA 5' ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA. CGCACAAACTTCAAGCAATC ||| :: : 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || 3' CTAACGAACTTCAAACACGC 5' CGCACAAACTTCAAGCAATC || :: :: :: 3' CTAACGAACTTCAAACACGC. gi|8 977 608|emb|AL1 370 17. 9| Human DNA sequence from clone RP11 44.1 0.41 gi|34495 171 |gb|AC1403 07. 3| Mus musculus BAC clone RP23-389D15 40.1 6.4 gi|62659432|ref|XM_ 579 802.1| PREDICTED: Rattus
  • 6
  • 335
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 6 doc

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 6 doc
. lược phát triển cây dứa Cayenne những năm gần đây. Tỷ lệ nhiễm PMWaV-1 cao trên cả hai nguồn giống này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu đang tiềm ẩn trên các vùng dứa vừa được phát. PMWaV-1 trên cả 3 giống dứa Cayenne được giám định đều rất cao, giống Thái Lan: 53,3%, giống Trung Quốc: 46, 7% và giống Lâm Đồng: 46, 7%. Kết quả này cho thấy một nguy cơ lớn của bệnh héo đỏ đầu lá. đề nghị sau: ¾ Tiếp tục mở rộng khảo sát trên nhiều vùng dứa khác để đánh giá chính xác tình hình bệnh héo đỏ đầu và nhiễm PMWaV-1 trong nước. ¾ Kết hợp với quy trình phát hiện PMWaV-2
  • 10
  • 284
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 5 ppt

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 5 ppt
. PMWaV-1. Như vậy, có thể kết luận quy trình RT-PCR được xây dựng hoàn toàn đủ độ tin cậy trong việc phát hiện PMWaV-1. Hình 4. 5: Sơ đồ phản ứng RT-PCR phát hiện PMWaV-1 . mức 45 chu kỳ được chọn mức thích hợp nhất cho phản ứng RT-PCR. L 1 2 3 4 5 58 9 bp 50 0 bp 50 Trong suốt quá trình xây dựng quy trình RT-PCR trên, ngoài vạch sản phẩm chính 58 9. tăng lên. Tuy nhiên, quy trình RT-PCR trên được xây dựng với mục đích phát hiện PMWaV-1 trên những mẫu chồi với lượng bản sao RNA virus ban đầu rất thấp nên chúng tôi quy t định chấp nhận
  • 10
  • 375
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 4 pptx

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 4 pptx
. trình sau Bảng 3. 1: Các chu trình nhiệt của phản ứng RT-PCR được khảo sát Chu trình nhiệt Giai đoạn 1 2 3 4 5 Tạo cDNA 45 o C /45 ’ 94 o C/2’ 45 o C /45 ’ 94 o C/2’ 45 o C /45 ’ 94 o C/2’. 3.2.3 .4 Xác định số chu kỳ phản ứng tối ưu. Phản ứng RT-PCR được thực hiện ở 5 mức 41 , 42 , 43 , 44 , 45 chu kỳ để xác định số chu kỳ cho hiệu quả khuếch đại tối ưu. 3.3 .4 Điện di sản phẩm RT-PCR. 94 o C/2’ 45 o C /45 ’ 94 o C/2’ 45 o C /45 ’ 94 o C/2’ Khuếch đại cDNA 92 o C/30’’ 52 o C/1’ 68 o C/1’30’’ ( 45 chu kỳ ) 92 o C/30’’ 54 o C/1’ 68 o C/1’30’’ ( 45 chu kỳ )
  • 10
  • 433
  • 1

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 3 potx

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 3 potx
. mật độ ấu trùng trên 30 0 con /cây thì cây bị nhiễm bệnh nặng. - Một số thống kê về tình hình bệnh đỏ đầu của trường Đại học Nông Lâm TP.HCM cho thấy bệnh héo đỏ đầu xuất hiện ở các vùng. của cây dứa, đem lại hiệu quả kinh tế cao cho xã hội 2.6 Các phương pháp chẩn đoán PMWaV Từ các nghiên cứu về bệnh héo đỏ đầu đã thực hiện trên thế giới cho thấy, hiện nay có 3 phương pháp. dứa hiện nay (chương trình 3 cây, 3 con của thành phố Hồ Chí Minh) thì rất cần phải xây dựng một quy trình phòng trừ bệnh thật sự hiệu quả. Từ thành quả của những nghiên cứu đã được thực hiện
  • 10
  • 287
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 1 pdf

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 1 pdf
. ***000*** KHÓA LUẬN TỐT NGHIỆP XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV -1 GÂY BỆNH HÉO ĐỎ ĐẦU (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR Giáo. HÌNH TRANG Hình 2. 1: Cây dứa 3 Hình 2. 2: Dứa Cayenne 7 Hình 2. 3: Cây dứa Cayenne bị héo đỏ đầu 10 Hình 2. 4: Quả của cây dứa bị héo đỏ đầu 10 Hình 2. 5: Rệp xám (Dysmicoccus neobrevipes),. 2.4 Bệnh héo đỏ đầu trên cây dứa 9 2.5 Một số nghiên cứu về bệnh héo đỏ đầu trên thế giới và ở Việt Nam. 13 2.6 Các phương pháp chẩn đoán PMWaV 15 2.7 Gene HSP 70 của PMWaV -1 16 2.8 Phương
  • 10
  • 330
  • 0
1 2 3 4 .. >