Tổng hợp tài liệu :

HIV y học

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học:
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya" . more in- depth picture of the impact of the post-election crisis on the clinical care system and to corrobo-rate the findings of the database analysis. The. system during the time of thepost-election crisis. We used purposive sampling to iden-tify key informants, including physicians, nurses, andclinical officers,
  • 10
  • 575
  • 0

Báo cáo y học: "HIV DNA and Dementia in Treatment-Naïve HIV-1-Infected Individuals in Bangkok, Thailand"

Báo cáo y học:
Báo cáo y học: "HIV DNA and Dementia in Treatment-Naïve HIV-1-Infected Individuals in Bangkok, Thailand" . HIV DNA in PBMC as a risk for HAD in HAART-experienced individuals; and preliminary analyses suggest that the majority of this HIV DNA may be in circulating. determined by ELISA serotyping using V3-CM237 (Thai subtype B) and V3 CM242 (subtype E) peptides, which distinguishes HIV-1 subtype B and E infection in Thai
  • 6
  • 457
  • 1

Báo cáo y học: "Differential gene expression in HIV/SIV-associated and spontaneous lymphomas"

Báo cáo y học:
Báo cáo y học: "Differential gene expression in HIV/SIV-associated and spontaneous lymphomas" . factors and a variety of genes may contribute to the chain of events that eventually lead to lymphomagenesis. In an initial study to identify genes differentially. ND4, and SMG-1 genes in human spontaneous lymphomas and normal B- and T-lymphocytes. (a) 32P-labeled PCR-fragments of the set and a-myb oncogenes, and ND4,
  • 7
  • 334
  • 0

đánh giá kết quả điều trị bằng thuốc ức chế virus ARV trên bệnh nhân HIV/AIDS tại viện y học lân sàng các bệnh nhiêt đới0

đánh giá kết quả điều trị bằng thuốc ức chế virus ARV trên bệnh nhân HIV/AIDS tại viện y học lân sàng các bệnh nhiêt đới0
đánh giá kết quả điều trị bằng thuốc ức chế virus ARV trên bệnh nhân HIV/AIDS tại viện y học lân sàng các bệnh nhiêt đới . dịch (chủ y u là tế bào TCD4). • Đánh giá các phản ứng phụ của các thuốc ARV trong các phác đồ điều trị. • Đưa ra khuyến nghị về sử dụng thuốc ARV. T T. À I I • Đánh giá tác dụng của các phác đồ sử dụng 2 loại và 3 loại thuốc ức chế vi rút trên bệnh nhân HIV/AIDS cả về diễn biến Lâm sàng và thay đổi miễn
  • 30
  • 549
  • 4

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
. proteoliposomes containing CD4 and CCR5. A: Binding of the 35S-labelled soluble version of gp120/gp41, strain JR-FL to CD4- CCR5 or only CCR5 containing. XbaIsites, and inserting the gene between the corresponding sites into the polylinker of pcDNA3. CD4- his was made by cutting a CD4 His6construct (kindly donated by
  • 12
  • 438
  • 0

Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx

Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx
. the unfolding story of the modulation of the oligomeric structures of HIV-1 viral enzymes by synthetic peptides and small molecules. ACKNOWLEDGEMENTS The. REVIEW ARTICLE Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules Nicolas Sluis-Cremer1 and Gilda
  • 9
  • 402
  • 0

Báo cáo Y học: Solution structure of the HIV gp120 C5 Domain pptx

Báo cáo Y học: Solution structure of the HIV gp120 C5 Domain pptx
. interaction, the solution structure of the C5 domain of HIV gp120 has beendetermined by NMR spectroscopy.EXPERIMENTAL PROCEDURES The HIV gp120 C5 domain was. in the gp120 X-ray structure; thus, the C5 domain can be overlaid with the Cterminus of the gp120 X-ray structure (the RMSD of the NMR VKI backbone to the
  • 8
  • 322
  • 0

Báo cáo Y học: Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant doc

Báo cáo Y học: Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant doc
. Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant Jimmy Lindberg1,. aresuperimposed in the mutant NNIBP. The cyclopropyl-group of MSC194 and the methyl group of PNU142721 partly overlap the trifluoromethyl group of Efavirenz. Furthermore,
  • 8
  • 464
  • 0

Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx

Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx
. Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization Tokio Yamaguchi,1Iyoko. theprocess of AIDS myopathy development, AZT or oxidativeagents directly impair the energy-producing system of mitochondria, causing dysfunction of cellular
  • 7
  • 285
  • 0

BÀI BÁO CÁO VI SINH Y HỌC VIRUS HIV pot

BÀI BÁO CÁO VI SINH Y HỌC VIRUS HIV pot
. Báo cáo Vi Sinh Y Học – Virus HIV Đại Học Quốc Gia Tp. Hồ Chí Minh Trường Đại Học Khoa Học Tự Nhiên Khoa Sinh Học  BÀI BÁO CÁO VI SINH Y HỌC VIRUS HIV SINH VI N: MSSV: LÊ THỊ. 0915138 NGUYỄN THỊ HƯỜNG 0915213 I. Virus HIV và tình hình nhiễm HIV 1. Virus HIV HIV là chữ vi t tắt của virus g y AIDS bằng tiếng Anh Human-Immuno-Deficiency -Virus, có nghĩa là virus làm suy giảm. HIV được phát hiện. Số người trẻ nhiễm HIV ng y càng gia tăng và sự l y truyền qua đường tình dục khác giới bắt đầu xuất hiện nhiều hơn II. Retro Virus 2 / 20 Báo cáo Vi Sinh Y Học – Virus HIV Retrovirus
  • 20
  • 2,536
  • 5

Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot
. modifications when comparing the isolated domains of (1–51 )Vpr [25] and (52–96 )Vpr [26] with the intact Vpr protein. The differences in structure are localized to the N-terminal domain. The secondary structures. portion of the protein and allow its tight binding to Lys-tRNA synthetase [15]. The C-terminal domain (52–96 )Vpr and not the N-terminal domain (1–51 )Vpr, has been shown to bind viral proteins such. NMR structure of the HIV-1 regulatory protein Vpr in H 2 O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains K. Wecker, N. Morellet, S. Bouaziz and
  • 10
  • 383
  • 0

Phòng trị HIV/AIDS bằng y học thiên nhiên docx

Phòng trị HIV/AIDS bằng y học thiên nhiên docx
. x y ra nhanh hơn. NGUYÊN TẮC ĐIỀU TRỊ BẰNG Y HỌC THIÊN NHIÊN Với thuốc t y, người ta cho dùng 3 thuốc phối hợp khi xét nghiệm máu th y chỉ số CD4 dưới 500/cc. Với y học thiên nhiên, h y. Phòng trị HIV/AIDS bằng y học thiên nhiên Từ khi x y ra bệnh liệt kháng HIV/AIDS đến nay, toàn thế giới đã có trên 25.000.000 người chết vì đại dịch n y. Tại nước ta, tính. (Scutellaria barbata) 30 g, Cúc hoa (Chrysanthemum morifolium) 20 g, Cẩm chướng (cả c y - Dianthus caryophyllus) 30 g, rau Giấp cá (Houtuynia cordata) 30 g, Cam thảo (Glycyrrhiza glabra) 20 g. Dược liệu
  • 5
  • 268
  • 0

Báo cáo y học: "Hiệu quả điều trị của 2 phác đồ d4T + 3TC + NVP và d4T + 3TC + EFC ở bệnh nhân nhiễm HIV/AIDS tại Bệnh viện 103 " doc

Báo cáo y học:
. stavudine (d4T) + lamivudine (3TC) + nevirapine (NVP) và stavudine + lamivudine + efavirenz (EFV). Đề tài đợc thực hiện với mục tiêu: ánh giá hiệu quả điều trị của 2 phác đồ d4T + 3TC + NVP và d4T. quả điều trị 72 BN nhiễm HIV/AIDS ngời lớn bằng 2 phác đồ d4T + 3TC + NVP và d4T + 3TC + EFV trong thời gian 6 tháng cho th y đáp ứng điều trị rõ rệt theo chiều hớng cải thiện tình trạng bệnh, . HIV/AIDS, 15 tuổi, điều trị ngoại trú tại Khoa Truyền nhiễm, Bệnh viện 103, sử dụng thuốc kháng retrovirus (ARV) theo phác đồ d4T + 3TC + NVP (nhóm 1, n = 36) hoặc d4T + 3TC + EFV (nhóm 2, n = 36),
  • 7
  • 325
  • 0

Báo cáo y học: "THựC TRạNG HOạT ĐộNG TƯ VấN XéT NGHIệM Tự NGUYệN PHòNG CHốNG HIV/AIDS TạI 20 TỉNH/THàNH PHố THUộC Dự áN QUỹ TOàN CầU NĂM 2006 2007" pot

Báo cáo y học:
. THựC TRạNG HOạT ĐộNG TƯ VấN XéT NGHIệM Tự NGUYệN PHòNG CHốNG HIV/AIDS TạI 20 TỉNH/THàNH PHố THUộC Dự áN QUỹ TOàN CầU NĂM 200 6 - 200 7 Đào Xuân Vinh* và CS TóM TắT T vấn xét nghiệm tự nguyện. mô tả hoạt động VCT trong phòng chống HIV/AIDS tại 20 tỉnh/thành phố sau 2 năm triển khai Dự án. * Từ khoá: Phòng chống HIV/AIDS; Xét nghiệm tự nguyện. ACTIVity OF HIV/AIDS VOLUNTARY COUNSELING. VấN Đề Dự án “Tăng cờng chăm sóc, t vấn, hỗ trợ ngời nhiễm HIV/AIDS và các hoạt động phòng chống HIV/AIDS dựa vào cộng đồng ở Việt Nam” do Quỹ toàn cầu tài trợ đợc triển khai tại 20
  • 26
  • 423
  • 0

Báo cáo y học: "HIV-1 Capsid Assembly Inhibitor (CAI) Peptide: Structural Preferences and Delivery into Human Embryonic Lung Cells and Lymphocyte" pptx

Báo cáo y học:
. Ivyspring International Publisher. All rights reserved Research Paper HIV-1 Capsid Assembly Inhibitor (CAI) Peptide: Structural Preferences and Delivery into Human Embryonic Lung Cells and. the pharmacologically active CAI-peptide into human lymphocytes and Human Embryonic Lung cells (HEL) using the BioShuttle platform. Generally, the transfer of pharmacologically active substances. (MA), nucleocapsid p9 (NC), p4 and capsid p24 (CA) and SP1 and SP2 re- spectively [9]. The assembly of Gag proteins into im- mature viral particles followed by proteolytic disas- sembly of the
  • 10
  • 346
  • 0

Báo cáo y học: "Transduction of Cu, Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into human chondrocytes" docx

Báo cáo y học:
. 1 of 8 (page number not for citation purposes) Vol 8 No 4 Research article Transduction of Cu, Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into human chondrocytes Hyun. inhibition of apoptosis by transduction of anti-apop- totic Bcl- XL protein in explant cultured human chondrocytes and in human islet cells [22,23], induction of chemosensitivity by transduction of cytosine. HY, Eum WS, Jang HW, Kang JH, Ryu J, Lee BR, Jin LH, Park J, Choi SY: Transduction of Cu, Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into mamma- lian cells. FEBS Lett
  • 8
  • 360
  • 0

Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf

Báo cáo y học:
. frag- ment is expected. The following primers were used: 1, For- ward Tar: 5'-GCAATGATGTCGTAATTTGC and 2, Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC. HIV-1 infection of thymocytes Thymocytes. biopsies analyzed 60 to 70 days post engraft- ment showed that both Tar and Tar- CCR5Rz transduced progenitor cells matured into T- lymphocytes. During the normal course of thymopoiesis, the T cell precursors. respectively. The stained cells were analyzed by two color FACS. A, Isotype control. B, thymocytes from a control animal; C, thymocytes from a HIV-1 Tar animal; D, thymocytes from a HIV-1 -Tar- CCR5Rz
  • 11
  • 223
  • 0

Báo cáo y học: " HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector" ppt

Báo cáo y học:
. non-transduced and trans- duced cells. Primers specific for CXCR4 (forward: 5'-ggag- gggatcagtatatacacttc and reverse: 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc. Central Page 1 of 12 (page number not for citation purposes) AIDS Research and Therapy Open Access Research HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific. RNA decoy as a strategy for gene therapy in AIDS. Proc Natl Acad Sci USA 1993, 90:8000-8004. 8. Bai J, Gorantla S, Banda N, Cagnon L, Rossi J, Akkina R: Character- ization of anti -CCR5 ribozyme-transduced
  • 12
  • 211
  • 0
1 2 3 4 .. >