Tổng hợp tài liệu :

PCR based molecular diagnostic assays for Brucellosis: A review

A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY

A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
VIETNAM NATIONAL UNIVERSITY, HANOICOLLEGE OF FOREIGN LANGUAGESDEPARTMENT OF POSTGRADUATE STUDIES . evaluate the reliability of the final Achievement Computer-based MCQs Test 1 for the 4th semester non- English majors at Hanoi University. Another reason for the selection of testing a matter of study lies in the fact that the current language testing at Hanoi University of Business and Technology
  • 71
  • 786
  • 0

A CASE BASED DECISION SUPPORT SYSTEM FOR INDIVIDUAL STRESS DIAGNOSIS USING FUZZY SIMILARITY MATCHING

A CASE BASED DECISION SUPPORT SYSTEM FOR INDIVIDUAL STRESS DIAGNOSIS USING FUZZY SIMILARITY MATCHING
A CASE BASED DECISION SUPPORT SYSTEM FOR INDIVIDUAL STRESS DIAGNOSIS USING FUZZY SIMILARITY MATCHING
  • 13
  • 494
  • 0

Tài liệu Báo cáo khoa học: "A Graph-based Semi-Supervised Learning for Question-Answering" doc

Tài liệu Báo cáo khoa học:
. dcharacterizing the entailmentinformation between them.3 Graph Based Semi-Supervised Learning for Entailment RankingWe formulate semi-supervised entailment. DepartmentUniversity of Californiaat BerkeleyBerkeley, CA, 94720zhiheng@eecs.berkeley.eduAbstractWe present a graph-based semi-supervised learning for the question-answering
  • 9
  • 407
  • 1

Tài liệu Báo cáo khoa học: "A FrameNet-based Semantic Role Labeler for Swedish" pdf

Tài liệu Báo cáo khoa học:
. 436–443,Sydney, July 2006.c2006 Association for Computational LinguisticsA FrameNet-based Semantic Role La beler for SwedishRichard Johansson and Pierre. pierre}@cs.lth.seAbstractWe present a FrameNet-based semantic role labeling system for Swedish text. Astraining data for the system, we used anannotated
  • 8
  • 409
  • 0

Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Báo cáo
. using ISO 9000 factors for an evaluation and a strategic planning. The final step is to build a Web-based DSS application based on AHP model for an evaluation. organizations in Vietnam and Asia [3]. However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic planning. For
  • 12
  • 440
  • 0

Pulmonary tuberculosis diagnostic delays in Chad: a multicenter, hospital-based survey in Ndjamena and Moundou potx

Pulmonary tuberculosis diagnostic delays in Chad: a multicenter, hospital-based survey in Ndjamena and Moundou potx
. this article as: Ndeikoundam Ngangro et al.: Pulmonary tuberculosis diagnostic delays in Chad: a multicenter, hospital-based survey in Ndjamena and Moundou. . E AR C H A R T I C L E Open Access Pulmonary tuberculosis diagnostic delays in Chad: a multicenter, hospital-based survey in Ndjamena and Moundou Ndeindo
  • 13
  • 459
  • 0

Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx

Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx
. is the initial concentration of MABA-CDP bound to the enzyme, A is its total concentration, and P is the total concentration of human UCK. Data were analyzed using. Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site Dimitri Topalis1,*,
  • 11
  • 371
  • 0

The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
. The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices. into the process as well. Regional organizations and institutions can help facilitate cooperation and coordination and international financial institutions
  • 125
  • 1,175
  • 0

Báo cáo khoa học: "Evaluating Centering-based metrics of coherence for text structuring using a reliably annotated corpus" doc

Báo cáo khoa học:
. Evaluating Centering-based metrics of coherence for text structuring using a reliably annotated corpusNikiforos Karamanis,♣Massimo Poesio,♦Chris. field of text- to -text generation (Barzilay etal., 2002; Lapata, 2003), we assume that the in-put to text structuring is a set of clauses. Theoutput of text
  • 8
  • 547
  • 0

Báo cáo khoa học: "A Syllable Based Word Recognition Model for Korean Noun Extraction" potx

Báo cáo khoa học:
. A Syllable Based Word Recognition Model for Korean Noun ExtractionDo-Gil Lee and Hae-Chang RimDept or“(jeog)” is also regarded as a word because it isan uninflected morpheme.3 Syllable based word recognition model A Korean syllable consists of an obligatory
  • 8
  • 329
  • 0

Báo cáo khoa học: "Designing a Task-Based Evaluation Method ology for a Spoken Machine Translation System" pot

Báo cáo khoa học:
. Goals of a Task-Based Evaluation Methodology for an MT System The goal of a task-based evaluation for an MT system is to convey whether speakers'. Designing a Task-Based Evaluation Methodology for a Spoken Machine Translation System Kavita Thomas Language Technologies Institute Carnegie Mellon
  • 4
  • 325
  • 0

Báo cáo y học: "The clinical utility of molecular diagnostic testing for primary immune deficiency disorders: a case based review" doc

Báo cáo y học:
. this article as: Ameratunga et al., The clinical utility of molecular diag- nostic testing for primary immune deficiency disorders: a case based review Allergy, Asthma & Clinical Immunology. immunology@xtra.co.nz 1 Department of Clinical Immunology Auckland City Hospital, Park Rd, Grafton, Auckland New Zealand Full list of author information is available at the end of the article Ameratunga. symptomatic primary immune deficiency disor- der in adults. Patients present with hypogammaglobu- linemia, which is associated with an increase in autoimmunity, malignancy and allergy. Approximately Figure
  • 9
  • 412
  • 0

báo cáo khoa học: " Pharmacy-based needle exchange in New Zealand: a review of services" ppt

báo cáo khoa học:
. Regulations 1998 that govern the authorised sale of needles and syringes in New Zealand state that all sales of injecting equipment in New Zealand must be accompanied by some educational material. Table 2. Nicola Greenhill 3 and Andrew Smith 4 Address: 1 School of Pharmacy, University of Auckland, 85 Park Road, Grafton, Auckland, New Zealand, 2 National Manager, Needle Exchange Programme New Zealand,. in this manner. From a pharmacy perspective, a lack of pri- vate area and training have been identified as being barri- ers to greater involvement in information provision [10]. Training is an
  • 9
  • 166
  • 0

Carbon nanotubes and branched DNA based nucleic acid assays towards a PCR free detection and quantification of nucleic acids

Carbon nanotubes and branched DNA based nucleic acid assays towards a PCR free detection and quantification of nucleic acids
. CARBON NANOTUBES AND BRANCHED-DNA BASED NUCLEIC ACIDS ASSAYS: TOWARDS A PCR-FREE DETECTION AND QUANTIFICATION OF NUCLEIC ACIDS LEE AI CHENG (M.Sc., NTU, Singapore). based on signal amplification approach. Electrochemical and optical nucleic acids assays based on (I) a novel carbon nanotube (CNT) -based label, (II) a branched DNA (bDNA) amplifier have been. Successful detection of the p185-ssDNA by both CNT -based label and bDNA hybridization assays indicated good integrity and functionality of the standard. The approach offers a means to prepare standard
  • 226
  • 291
  • 0

Alternate wetting and drying (AWD) irrigation - A smart water saving technology for rice: A Review

Alternate wetting and drying (AWD) irrigation - A smart water saving technology for rice: A Review
The agricultural sector faces daunting challenges because of climate change, particularly amidst increasing global water scarcity, which threatens irrigated lowland rice production. By 2025, 15-20 million ha of irrigated rice is estimated to suffer from some degree of scarcity. Rice systems provide a major source of calories for more than half of the world‟s population; however, they also use more water than other major crops. Irrigated lowland rice not only consumes more water but also causes wastage of water resulting in degradation of land. In recent years to tackle this problem, many methods of cultivation have been developed. Among the different methods of water-saving irrigation, the most widely adopted is Alternate Wetting and Drying (AWD) irrigation method. AWD technique has developed by IRRI in partnership with national agricultural research agencies in many countries. Practical implementation of AWD was facilitated using a simple tool called a ''field water tube''. It is an irrigation practice of introduction of unsaturated soil conditions during the growing period that can reduce water inputs in rice without compromising yields. AWD technique can save water requirement up to 20-50% and improve water use efficiency besides reducing greenhouse gas emissions by 30-50%. which have impact on climate change. However, AWD has not been widely adopted, in part, due to the apprehension of yield reductions and hence demands greater efforts from researchers and extension workers. Safe AWD threshold level found to be 5-15cm water fall below surface in field water tube which needs to be validated in different soil types and different climatic conditions. Proper management of water in safe threshold is the foundation of AWD to realize potential yield while saving water. ... kg ha-1), irrigation once in days (3020 kg ha-1), irrigation for days and no irrigation for days (3800 kg ha-1) and irrigation for days and no irrigation for days (3610 kg ha-1) but irrigation. .. promising for adoption by the farmers (Li and Barker, 2004) Alternate wetting and drying irrigation practice Alternate wetting and drying (AWD) irrigation is a water saving technology that reduces... simplicity and can be locally fabricated AWD irrigation had significant effect on water saving and water productivity of rice There was a saving of irrigation water by 2 0-5 0% over normal submergence Water
  • 11
  • 3
  • 0

Utilization of spent hen meat for soup: A review

Utilization of spent hen meat for soup: A review
Soup can be prepared from different food ingredient in different forms, of which dry soup mixes are more preferred by consumers because of its convenience, ease in preparation, shelf stability and popular appetizing capability. Spent hen meat can effectively be utilized in preparation of instant soup mix powder to overcome its poor acceptability and lowers remunerative prices. Method of drying and temperature applied during drying have key role on quality, shelf stability and consumer acceptability of the final product. Pretreatments like shredding, pressure cooking, proper drying, treating with flavouring, tenderizing and thickening agents may involve in further improvement of the product quality. ... Dikeman, M Eds Encyclopaedia of Meat Sciences V London, Elsevier Ltd pp 402-411 Maiti, A. K., Ahlawat, S.S., Sharma, D.P and Khanna, N (2008) Application of Natural Tenderizers in Meat- A Review Agric... storage (Sallam et al., 2004) Antioxidant activity of mint extract as a natural antioxidant is comparable to the synthetic antioxidant, butylated hydroxytoluene (BHT) in terms of TBARS values (Kanatt... remunerative prices Thus effective utilization of spent hen meat is one of the urgent demands of the poultry industry Utilization of nutritious, easily available and economically viable spent hen meat
  • 8
  • 6
  • 0

PCR based molecular diagnostic assays for Brucellosis: A review

PCR based molecular diagnostic assays for Brucellosis: A review
Brucellosis is a worldwide re-emerging zoonotic disease of public health and economic importance. It affects a large number of domestic as well as wild animals and results in heavy losses to the animal husbandry sector. The direct culture of bacteria and serological test are the gold standard for Brucella spp. identification in the clinical samples. However, these assays have various limitations therefore PCR can be a potential tool to address aforesaid limitations and can be used for early detection of causative agents in disease condition. In this review, we have tried to discuss most of the currently used PCR based methods for detection of Brucella at genus and species level in different biological samples. Now a day, these assays are becoming very important tools for the identification of Brucella at genus, species and biovar level. ... article: Vinay Kumar, Nitish Bansal, Trilok Nanda, Aman Kumar, Rajni Kumari and Sushila Maan 2019 PCR Based Molecular Diagnostic Assays for Brucellosis: A Review Int.J.Curr.Microbiol.App.Sci 8(02):... Kumar, A. , Batra, K., Chaudhary, D., Dalal, A. , Gupta, A. K., Bansal, N., Sheoran, N and Maan, N.S (2017) Real time PCR assay for differentiation of Brucella abortus and Brucella melitensis Indian... Dwivedi, D., Andani, D., Kumar, A and Goswami, T.K (2017) Comparative diagnostic evaluation of OMP31 gene based TaqMan® real-time PCR assay with visual LAMP assay and indirect ELISA for caprine brucellosis
  • 16
  • 11
  • 0

A simple, efficient and universal method for the extraction of genomic DNA from bacteria, yeasts, molds and microalgae suitable for PCR-based applications

A simple, efficient and universal method for the extraction of genomic DNA from bacteria, yeasts, molds and microalgae suitable for PCR-based applications
The extraction of genomic DNA from microbial cells plays a significant role in PCR-based applications such as molecular diagnosis, microbial taxonomy, screening of genetically engineered microorganisms, and other such PCRbased applications. Currently, many methods for extraction of genomic DNA from microorganisms have been developed. However, these methods either require hazardous chemicals or consist of time-consuming steps for effective execution. In this study, we have established a simple and universal genomic DNA extraction method for different microorganisms including bacteria, yeasts, molds, and microalgae. Our method does not require harmful reagents such as phenol and chloroform for the extraction process to minimize the generation of hazardous wastes. The obtained genomic DNA products displayed high concentrations and represented a good purity level with the average 260 nm/280 nm absorbance ratios (A260/280) that range from 1.6 to 2.0. ... Fig The universal procedure of genomic DNA extraction for different microorganisms Fig Extraction of genomic DNA from bacteria, yeasts and microalgae (A) The genomic DNA (gDNA) products extracted... above for the extraction of genomic DNA from bacteria Analysis of the extracted genomic DNA products The genomic DNA products were analyzed on 0.7% agarose gels through electrophoresis and the DNA. .. oryzae and A (2013) [19] flavus Specific to AFB-F AAGCAAACCAAGACCAACAAG AFB-R AACAAGTCTTTTCTGGGTTCTA December 2017 • Vol.59 Number aflatoxin biosynthesis gene cluster in A flavus Chiba, et al
  • 9
  • 3
  • 0

Effectiveness of a cognitive behavioural therapy-based anxiety prevention programme for children: A preliminary quasi-experimental study in Japan

Effectiveness of a cognitive behavioural therapy-based anxiety prevention programme for children: A preliminary quasi-experimental study in Japan
As children’s mental health problems become more complex, more effective prevention is needed. Though various anxiety and depression prevention programmes based on cognitive behavioural therapy (CBT) were developed and evaluated in Europe, North America, and Australia recently, there are no programmes in Japan ... disseminate the program widely throughout Japanese schools Therefore, a programme that is easy for teachers to manage at school is being planned and a training manual is being prepared so that any... classes However, in conducting this study, advertising was used initially since it was a more practical and realistic approach for a Table 4  Estimated values and changes from baseline at each... shame’ in Japan [38] In Japan, prominent quantitative increases in anxious feelings for adolescents have been recognized in recent years ‘The increase in severity of social phobia’ is continuing
  • 12
  • 7
  • 0

Constructing a molecular genotyping assay for rs11077 based on real-time polymerase chain reaction high resolution melting (PCR HRM) technique for the prognosis of hepatocellular carcinoma (

Constructing a molecular genotyping assay for rs11077 based on real-time polymerase chain reaction high resolution melting (PCR HRM) technique for the prognosis of hepatocellular carcinoma (
XPO5 codes for the nuclear transport factor exportin-5, which is a membrane-bound protein. This gene is responsible for the transport of pre-miRNA from the nucleus to the cytoplasmic compartments, thereby adjusting the whole miRNA expression level. The reduction of the miRNA levels was recorded when XPO5 was knocked down. rs11077 is found in the 3′UTR region of XPO5, and this SNP might affect mRNA stability and be associated with the altered expression of XPO5. This leads to the universal suppression of miRNA expression profiles, thereby mediating the HCC survival. HCC patients bearing C/C and A/C genotypes of rs11077 had a survival rate of 60% after 3 years; and this rate was reduced to 24.7% with HCC patients bearing the A/A genotype. In this study, we constructed a molecular assay based on a real-time PCR HRM technique for rs11077 genotyping. ... up a realtime PCR HRM reaction on five human DNA samples The results are illustrated in Fig CN13: AGTACCTCCAAGGACCAGG CN14: AAAGGGGATGTTAGCACTAAAGAC CN15: CCTTTTGCTGCTGGGCTGG CN16: TGAGTGGACCTTGAGGCTG ... occurrence of the peaks corresponding to the nucleotides of rs11077 Specifically, the sample containing the genotype A/ A contained a peak of Adenine, and the sample containing the genotype C/C contained... was analysed based on the fluorescence signals and was then compared to the original sequence containing rs11077 on GenBank nucleotide database Analytical specificity The selective amplification
  • 7
  • 5
  • 0
1 2 3 4 .. >